Cascos de Predator

cascos-predator-rusos La compañía rusa Nitronos es especialista en customizar cascos de moto. Su línea de Predator no para de sacar nuevos modelos, y a esto se han unido otras variantes como los cascos Sparta o los de estilo gatuno japonés.

predator-cascocascos de predatorpredator-casco-tiapredator-casco-chica

La línea de cascos Spartanos

Más fotos en su Instagram: Helmets. A la venta en su web oficial:


Comentarios (34)

Inicia sesión o Regístrate en Yonkis para comentarOrdenar por votos

  1. SirCat

    Si me pongo uno de esos en mi vesta de 49 no se yo si voy a acojonar mucho… Pero me gustan mucho.

  2. yogurblanco

    Los de espartanos también vienen bien para cepillar la moto. Es un dos por uno.

    • zurrimierdas

      buen aporte, muy guapos

  3. Johnny Techno

    Que ojete tiene la pava comassuspensivas,,,

  4. ovejo

    Disculpad mi ignorancia, pero ¿Se puede usar un casco de esos sin riesgo a que multen? Dudo mucho que el de las orejas de gato, o el del espartano estén homologados

    • Zhatan

      Si han pasado el test de seguridad ISO9001 es que no presentan problemas de protección y/o obstaculizan movimientos o visión, por lo tanto son usables. el problema son los de los chinos que parecen normales pero están rellenos de corchopan.

    • Kiko NWO

      Aprovecho para formular una pregunta yo también, ¿al comprar el casco, va incluida la modelo gatuna?, y no menos improtante, ¿hay que darle de comer leche, o sables?, me parece una falta de respeto que no se mencionen esos detales, imagino que como en todo los servicios sexuales te los cobrarán aparte del precio inicial… no merece la pena.

      Kiko NWO
      • hacienDoamiGos

        Y a tí que más te dá. Te ponen una de esas delante y no sabes ni por dónde empezar, FANTASMA.

    • Sultans of trash

      De hecho son antimultas: Póntele, dále un poco de vidilla a la moto y las rastas del predator empezarán a fustigarte hasta que no se te ocurra pasar de 80km/h. Sólo el correaje de una mochila ya pica que da gusto.

      Sultans of trash
      • Maki

        Lo mismo he pensado yo, como hagas una ruta de 300km oyendo el tactactactactactactac de las rastas golpeando el casco ibas a llevar el primer predator sking de la historia en la segunda salida en moto…

    • SrDavidRuiz

      En todo el mundo sí, en España la DGT criminal te multará.

  5. Zhatan

    Creo que esto es una compra fundamental para todo el que quiera sobrevivir a un holocausto nuclear. Está claro que si observamos Mad Max con detenimiento solo los que tengan un casco bien guapo y ropa de gayer sadomaso van a poder unirse a las bandas que dirigirán el planeta.

    • hacienDoamiGos

      Qué buena, me rompo el ojete. +1

  6. zurrimierdas

    El video de Nekane y Susy, me la ha puesto como el cañon de la estrella de la muerte.

    • Dirk Diggler


      Dirk Diggler
    • SrDavidRuiz

      +1. La nekane está mega increible. Mujeres con ese tipo hay muy pocas. Que tengan buen culo y buenas tetas no es común.

      • Kriptman

        Joder, creo que es tu mejor comentario en Yonkis ever!

  7. Rocamadour

    Justo ahora me estoy sacando el carnet para llevar motos grandes y para junio me gustaría pillarme un casco en condiciones. El caso es que me interesaría alguna empresa que los personalice pero dándole yo el diseño a serigrafiar, si coñoceis alguna agradecería el dato…

    • Funkalo

      Sale más caro el collar que el gato. Con la variedad de diseños que hay yo no me molestaría.

      • Rocamadour

        Es que por un tema personal… en junio conmemoro algo importante. Por ejemplo el año pasado me tatué para ese aniversario, los dos años anteriores fue la familia quienes tuvieron detalles muy bonitos, y éste verano me molaría prepararme el casco con un diseño mío. Podría intentar pintarlo yo, pero nunca he serigrafiado y se necesitaría un trazo mas bien fino…

        • fernanjos

          Mira a ver si te sirve esto

          • Rocamadour

            Guay, tienen buena pinta. Me guardo el enlace para cuándo se vaya acercando junio. Espero haberme sacado el carnet en un mes mas o menos, y luego lo que tarde en encontrar la burra. Me apetece mucho una Honda Shadow, y no parece muy difícil sacarla de segunda mano con mi presupuesto…

    • p3lirrojo

      Hay muchos profesionales/particulares que hacen serigrafías en cascos por poca pasta, dime tu zona y a ver si puedo recomendarte alguno. Yo conozco una chavala que hace con el aerógrafo autenticas piezas de calidad fotográfica… pero solo trabaja para equipos de ciclismo/motos/amiguetes.

      • Rocamadour

        Pues si, algo así busco, un particular o PYME al que le pueda llevar yo mismo el casco, darle el diseño, explicarle como lo quiero y que no me sangre una pasta descabellada. Y bueno, aunque no suelo dar datos personales supongo que no pasa nada por decir que ahora vivo en Extremadura, aunque tampoco tendría mucho problema en desplazarme a Salamanca o Andalucía por ejemplo.

    • mramericanbadass

      Para llevar “motos grandes”… Ajjajajajaja me parto…

    • p3lirrojo

      En serio te planteas ponerte eso???,,,,

  8. Funkalo

    Los de masei hacen cascos de Iron Man, pero no me pondría eso ni con vuestra cabeza, se tienen que abrir como sandías :

  9. p3lirrojo

    Que cosa mas fea cojones,,,

  10. genofinder

    desde el punto de vista de la eficiencia esos cascos son una cagada. sos antiaereodinamicos total. tanto las orejas como las rastas y como el escobon eso tiene que ofrecer una resistencia al viento de cojones. si alguien ha conducido a mas de 200km/h sabra de lo que hablo

    • hacienDoamiGos

      Hoy en barrio sésamo aprenderemos una nueva palabra: “aereodinámicos”.
      Ala niños, todos al oculista a que nos trasplanten las corneas quemadas.

  11. khayman

    Yo los cascos curiosos me parecen chulos para ver pero nunca los llevaría, a veces los guardias civiles se aburren e igual te paran para pasar el rato, ver el casco, ponerte una multa, lo típico.